Journal: Journal of medicinal chemistry

Article Title: Protein Stability Effects in Aggregate-Based Enzyme Inhibition

doi: 10.1021/acs.jmedchem.9b01019

Figure Lengend Snippet: Thermodynamic stabilities and binding affinities of TEM-1 mutants. (A) Location of TEM-1 mutations M182T (green), R164S (cyan), G238S (orange), and D179G (red) in TEM-1 M182T mutant PDB structure 1JWP relative to catalytic residues S70, K73, S130, and E166 (pink). (B) Melting temperatures of TEM-1 mutants determined by differential scanning fluorimetry (DSF) (see Table 1 for Tm and ΔΔG values). (C) The competitive displacement of 100 nM 5-maleimido-fluorescein-ribosomal protein L2 globular domain (5-MF-L2gd) bound to 20 μM Sor/CR colloids by TEM-1 stability mutants.

Article Snippet: 35 , 36 Incubation was performed for 20 nM TEM-1 and its mutants with varying concentrations of Sor/CR, Fulvestrant, TIPT, and Miconazole (MedChemExpress, HY-10201; Millipore Sigma, C6277; MedChemExpress, HY-13636; Spectrum Chemical, T0126; Santa Cruz Biotechnology, sc-204806) for 5 min at room temperature in 50 mM KPi, pH 7.0.

Techniques: Binding Assay, Mutagenesis

Journal: Journal of medicinal chemistry

Article Title: Protein Stability Effects in Aggregate-Based Enzyme Inhibition

doi: 10.1021/acs.jmedchem.9b01019

Figure Lengend Snippet: Thermodynamic stabilities and binding affinities of TEM-1 mutants in complex with moxalactam. (A) The chemical structure of moxalactam. (B) Change in melting temperatures of TEM-1 mutants incubated with 100-fold molar excess of β-lactamase inhibitor moxalactam relative to respective apo-enzymes, determined by DSF (see Table 2). The competitive displacement of 100 nM 5-MF-L2gd bound to 20 μM Sor/CR colloids by TEM-1 stability mutants, (C) WT and WT-inhibitor complex, (D) R164S and R164S-inhibitor complex, (E) D179G and D179G-inhibitor complex, and (F) M182T and M182T-inhibitor complex (see Tables 1 and ​and22 for EC50 values).

Article Snippet: 35 , 36 Incubation was performed for 20 nM TEM-1 and its mutants with varying concentrations of Sor/CR, Fulvestrant, TIPT, and Miconazole (MedChemExpress, HY-10201; Millipore Sigma, C6277; MedChemExpress, HY-13636; Spectrum Chemical, T0126; Santa Cruz Biotechnology, sc-204806) for 5 min at room temperature in 50 mM KPi, pH 7.0.

Techniques: Binding Assay, Incubation

Journal: Journal of medicinal chemistry

Article Title: Protein Stability Effects in Aggregate-Based Enzyme Inhibition

doi: 10.1021/acs.jmedchem.9b01019

Figure Lengend Snippet: TEM-1 inhibition dose–response curves against (A) Sor/CR, (B) Fulvestrant, (C) TIPT, and (D) Miconazole colloids (see Table 3 for IC50 values).

Article Snippet: 35 , 36 Incubation was performed for 20 nM TEM-1 and its mutants with varying concentrations of Sor/CR, Fulvestrant, TIPT, and Miconazole (MedChemExpress, HY-10201; Millipore Sigma, C6277; MedChemExpress, HY-13636; Spectrum Chemical, T0126; Santa Cruz Biotechnology, sc-204806) for 5 min at room temperature in 50 mM KPi, pH 7.0.

Techniques: Inhibition

Journal: mSystems

Article Title: Emergence of mcr-9.1 in Extended-Spectrum-β-Lactamase-Producing Clinical Enterobacteriaceae in Pretoria, South Africa: Global Evolutionary Phylogenomics, Resistome, and Mobilome

doi: 10.1128/mSystems.00148-20

Figure Lengend Snippet: Resistome and mobilome characteristics of the isolates

Article Snippet: K001 (ST-1791) , Klebsiella variicola , arr-3, fosA, sul2, aacA4, strB, strA, qnrB66, oqxB, oqxA, frA14, bla CTX-M-15 , bla LEN13 , bla TEM-1B , aac(6')Ib-cr , IncR, ColRNAI , IncF[K12:A-:B-] , In191, In792.

Techniques: Plasmid Preparation

Journal: Zoological Research

Article Title: The role of wildlife (wild birds) in the global transmission of antimicrobial resistance genes

doi: 10.24272/j.issn.2095-8137.2017.003

Figure Lengend Snippet: Presence of extended-spectrum β-lactamase (ESBL)-producing Enterobacteriaceae in wild animals

Article Snippet: European herring gull, Mallard, Black-headed gull, Egyptian goose, Feral pigeon, Grey heron, Mute swan, Northern gannet, Northern lapwing, Gadwall, Common redshank, Lesser black-backed gull, Tufted duck, Common gull, Common goldeneye, Common guillemot, Black swan, Barnacle goose, Ruff , 2010-2011 , E. coli , 65 , bla CTX-M-1 (14) bla CTX-M-15 (13) bla CTX-M-3 (8) bla CTX-M-14 (8) bla CTX-M-32 (3) bla SHV-12 (3) bla TEM-52c (1) bla SHV-12 +bla TEM-52c (1) , IncI1( bla CTX-M-1 ) (13), IncF ( bla CTX-M-1 ), IncB/O ( bla CTX-M-14 ), IncF ( bla CTX-M-14 ) (6), IncF ( bla CTX-M-15 ) (3), IncHI2 ( bla CTX-M-15 ), IncHI2-IncF ( bla CTX-M-15 ), IncI1 ( bla CTX-M-15 ) (4), IncI2 ( bla CTX-M-15 ), IncF ( bla CTX-M-3 )(6), IncI1 ( bla CTX-M-3 ), IncF ( bla CTX-M-32 ), IncF ( bla SHV-12 ), IncI1 ( bla SHV-12 ), IncN ( bla SHV-12 ), IncI1( bla SHV-12 +bla TEM-52c ), IncI1 ( bla TEM-52c ) , , , Netherlands , .

Techniques: Northern Blot

Journal: BioMed Research International

Article Title: Diffusion and Persistence of Multidrug Resistant Salmonella Typhimurium Strains Phage Type DT120 in Southern Italy

doi: 10.1155/2015/265042

Figure Lengend Snippet: Primers used for PCR amplification of resistance genes.

Article Snippet: Unnamed 6 , DT1 , 2008 (1) , ASSuT , − , − , bla TEM ; sul2 ; strAB ; tet(A) , − , −.

Techniques: Amplification, Sequencing

Journal: BioMed Research International

Article Title: Diffusion and Persistence of Multidrug Resistant Salmonella Typhimurium Strains Phage Type DT120 in Southern Italy

doi: 10.1155/2015/265042

Figure Lengend Snippet: Antimicrobial susceptibility, phage types, pulsotypes, PCR detection of SGI1, class 1 integrons, and resistance genes in S . Typhimurium strains isolated in Southern Italy in 2006–2008.

Article Snippet: Unnamed 6 , DT1 , 2008 (1) , ASSuT , − , − , bla TEM ; sul2 ; strAB ; tet(A) , − , −.

Techniques: Isolation, Transmission Electron Microscopy

Journal: Microorganisms

Article Title: Whole-Genome Sequencing-Based Resistome Analysis of Nosocomial Multidrug-Resistant Non-Fermenting Gram-Negative Pathogens from the Balkans

doi: 10.3390/microorganisms11030651

Figure Lengend Snippet: Whole-genome sequencing-based resistome studies of MDR, XDR, PDR, and colistin-resistant A. baumannii isolates from the Balkans.

Article Snippet: Albania , 1 isolate, CRAB, ST2/ST436 , 2015 , ampC , bla OXA-23 , bla MBL , bla OXA-51 , bla TEM-1 , armA , aph(3′)-Ia , aphA6 , strA , and strB , , sul2 , tetB , [ ] .

Techniques: Sequencing, Transmission Electron Microscopy, Bla VIM Assay

Journal: Antimicrobial Agents and Chemotherapy

Article Title: Role of Synonymous Mutations in the Evolution of TEM β-Lactamase Genes

doi: 10.1128/AAC.00018-21

Figure Lengend Snippet: Summary of the characteristics of the different bla TEM gene constructs without (−sm) and with (+sm) synonymous mutations

Article Snippet: Genes encoding the various bla TEM genes were purchased from Gen9, Inc. (Cambridge, MA) or Biomatik (Kitchener, ON, Canada); genes had a SacI restriction site followed by a ribosome binding site (5′- GAGCTCAAGAAGGAGATATACAT -3′) on the 5′ terminus and a BamHI restriction site (5′-GGATCC-3′) immediately following the 3′ terminal stop codon.

Techniques: Construct, Expressing

Journal: Antimicrobial Agents and Chemotherapy

Article Title: Role of Synonymous Mutations in the Evolution of TEM β-Lactamase Genes

doi: 10.1128/AAC.00018-21

Figure Lengend Snippet: Summary of the characteristics of the different gene constructs from bla TEM-1 to bla TEM-33 (+sm) c

Article Snippet: Genes encoding the various bla TEM genes were purchased from Gen9, Inc. (Cambridge, MA) or Biomatik (Kitchener, ON, Canada); genes had a SacI restriction site followed by a ribosome binding site (5′- GAGCTCAAGAAGGAGATATACAT -3′) on the 5′ terminus and a BamHI restriction site (5′-GGATCC-3′) immediately following the 3′ terminal stop codon.

Techniques: Construct, Diffusion-based Assay, Microdilution Assay

Journal: Frontiers in Microbiology

Article Title: Whole Genome Sequencing and Characteristics of mcr -1–Harboring Plasmids of Porcine Escherichia coli Isolates Belonging to the High-Risk Clone O25b:H4-ST131 Clade B

doi: 10.3389/fmicb.2020.00387

Figure Lengend Snippet: Plasmid content of the ST131 Escherichia coli isolates from porcine origin and location of resistance and virulence genes.

Article Snippet: , pLREC161_1 , 8 , 330,357 , 1 , MOB F12 , RptA1 , IncF [F2:A-:B1][IncHI2-ST-nt] i , iroBCDEN, iss, mchF, iutA, iucABCD , bla TEM–1C/ bla TEM–40/ bla TEM–135 , mcr-1.1, tet(A), tet(C), tet(R).

Techniques: Plasmid Preparation

Journal: Veterinary and Animal Science

Article Title: Exploring of spectrum beta lactamase producing multidrug-resistant Salmonella enterica serovars in goat meat markets of Bangladesh

doi: 10.1016/j.vas.2024.100367

Figure Lengend Snippet: Primers used in PCR test of Salmonella enterica serovars and Beta-lactams resistant genes.

Article Snippet: This study specifically concentrated on the isolation and identification of ESBL-resistant genes ( bla TEM, bla SHV, bla CTX-M1, bla CTX-M2, bla CTX-M9, MultiCase ACC, MultiCase MOX, MultiCase DHA, bla OXA ) and the antibiogram profiling of Salmonella enterica serovars found in goat meat samples procured from retail outlets in Bangladesh.

Techniques: Sequencing

Journal: Veterinary and Animal Science

Article Title: Exploring of spectrum beta lactamase producing multidrug-resistant Salmonella enterica serovars in goat meat markets of Bangladesh

doi: 10.1016/j.vas.2024.100367

Figure Lengend Snippet: Amplified DNA of invA gene of Salmonella isolates at 284 bp, PC: Positive control as Salmonella spp. ATCC 700623 ( A); sefA gene of Salmonella Enteritidis Isolated at 488 bp, PC: Positive control as Salmonella enterica ser. Enteritidis ATCC 13076 ( B); fliC gene of Salmonella Typhimurium Isolated at 620 bp, PC: Positive control as Salmonella enterica ser. Typhimurium ATCC 700720 ( C); NC: Negative control (Nuclease free water) Amplified DNA of ESBL Resistance genes of Salmonella spp. from first multiplex PCR test. Lane M: 100bp DNA Ladder, Lane M: 100bp DNA ladder, bla TEM gene at 800bp position. Lane 2: bla SHV gene at 713 bp ( D).

Article Snippet: This study specifically concentrated on the isolation and identification of ESBL-resistant genes ( bla TEM, bla SHV, bla CTX-M1, bla CTX-M2, bla CTX-M9, MultiCase ACC, MultiCase MOX, MultiCase DHA, bla OXA ) and the antibiogram profiling of Salmonella enterica serovars found in goat meat samples procured from retail outlets in Bangladesh.

Techniques: Amplification, Positive Control, Isolation, Negative Control, Multiplex Assay

Journal: Veterinary and Animal Science

Article Title: Exploring of spectrum beta lactamase producing multidrug-resistant Salmonella enterica serovars in goat meat markets of Bangladesh

doi: 10.1016/j.vas.2024.100367

Figure Lengend Snippet: Frequency of beta-lactams resistance genes in Salmonella Enteritidis and Typhimurium isolated from retail goat meat.

Article Snippet: This study specifically concentrated on the isolation and identification of ESBL-resistant genes ( bla TEM, bla SHV, bla CTX-M1, bla CTX-M2, bla CTX-M9, MultiCase ACC, MultiCase MOX, MultiCase DHA, bla OXA ) and the antibiogram profiling of Salmonella enterica serovars found in goat meat samples procured from retail outlets in Bangladesh.

Techniques: Isolation